Mb^em1Shad
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mb^em1Shad
• Name: myoglobin; endonuclease-mediated mutation 1, Sean H Adams
• MGI ID: MGI:6752552
• Synonyms: Mb^-
• Gene: Mb Location: Chr15:76899687-76934868 bp, - strand Genetic Position: Chr15, 36.36 cM
• Alliance: Mb^em1Shad page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: The gene was targeted with two gRNAs (targeting GAACTTGTCAAACTTATCCA and CGGTGCAACCATGCTTCTTC) using CRISPR/Cas9 technology, leading to a 199 bp deletion that includes the exon 2 splice acceptor and most of exon 2 (chr15:7690182276902020 (GRCm39)) in founder 14. This deletion causes the skipping of exon 2 and splicing of exon 1 to 3, which results in a reading frame shift and premature stop codon. (J:307655)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mb Mutation: 20 strains or lines available

References

• Original: J:307655 Ono-Moore KD, et al., Metabolic physiology and skeletal muscle phenotypes in male and female myoglobin knockout mice. Am J Physiol Endocrinol Metab. 2021 Jul 1;321(1):E63-E79
• All: 2 reference(s)