4930579G24Rik^em1Qsh
Endonuclease-mediated Allele Detail

Summary

• Symbol: 4930579G24Rik^em1Qsh
• Name: RIKEN cDNA 4930579G24 gene; endonuclease-mediated mutation 1, Qinghua Shi
• MGI ID: MGI:6753386
• Synonyms: C4orf46^-
• Gene: 4930579G24Rik Location: Chr3:79536386-79540127 bp, + strand Genetic Position: Chr3, 34.93 cM, cytoband F1
• Alliance: 4930579G24Rik^em1Qsh page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 1 was targeted with two sgRNAs (targeting GTTGGACCGGGACTCCTGCT and CGTGGACCCGCTGGAGCAAG) using CRISPR/Cas9 technology, resulting in a 32 bp deletion (CCCGGTCCAACCGTGGACCCGCTGGAGCAAGT) that causes a frameshift and premature stop codon (p.(Pro44Glyfs*13)). Western blot experiments confirmed the absence of full-length peptides in the testes. (J:307600)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any 4930579G24Rik Mutation: 7 strains or lines available

References

• Original: J:307600 Shah B, et al., Inactivation of testis-specific gene C4orf46 is dispensable for spermatogenesis and fertility in mouse. Mamm Genome. 2021 Jun 2
• All: 1 reference(s)