Pdp2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pdp2^em1(IMPC)J
• Name: pyruvate dehydrogenase phosphatase catalytic subunit 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6755467
• Gene: Pdp2 Location: Chr8:105318104-105325658 bp, + strand Genetic Position: Chr8, 53.04 cM
• Alliance: Pdp2^em1(IMPC)J page
• IMPC: Pdp2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGCAGAATTGAAGATCCAGT and CCATGACAGTGATATCATCC, which resulted in a 1510 bp deletion beginning at Chromosome 8 position 105,320,175 bp and ending after 105,321,684 bp (GRCm39/mm39). This mutation deletes 1510 bp from ENSMUSE00000334359 (exon 2) and is predicted to cause a change of amino acid sequence after residue 7 and termination 41 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pdp2 Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)