Zfp146^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp146^em1(IMPC)J
• Name: zinc finger protein 146; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6758799
• Gene: Zfp146 Location: Chr7:29860694-29869175 bp, - strand Genetic Position: Chr7, 17.29 cM
• Alliance: Zfp146^em1(IMPC)J page
• IMPC: Zfp146 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAATGAGTATGGATTTTC and AGCCAGCAGAGAATCTTAAG, which resulted in an 855 bp deletion beginning at Chromosome 7 position 29,861,159 bp and ending after 29,862,013 bp (GRCm39/mm39). This mutation deletes 855 bp from ENSMUSE00000393840 (exon 2) and is predicted to cause a change of amino acid sequence after residue 9 and termination 17 amino acids later. There is a 1 bp insertion (C) at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zfp146 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)