Kctd19^em1Osb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kctd19^em1Osb
• Name: potassium channel tetramerisation domain containing 19; endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University
• MGI ID: MGI:6758821
• Synonyms: Kctd19^del, Kctd19^em1Maik
• Gene: Kctd19 Location: Chr8:106109439-106140134 bp, - strand Genetic Position: Chr8, 53.04 cM
• Alliance: Kctd19^em1Osb page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exons 3 and 13 (or 12, depending on splice variant) were targeted with two sgRNAs (targeting TCCATGTCCGCCAGTAGTTC and AAAAAGAGCTATTACCCTAA) and tracrRNAs and crRNA using CRISPR/Cas9 technology, resulting in a 9620 bp deletion from the 3' end of exon 3 to the 5' end of exon 13 (12). Immunoblots confirmed the absence of peptide expression from this allele. (J:306305)

Expression

In Mice Carrying this Mutation:	18 assay results
In Structures Affected by this Mutation:	2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 6 strains available Cell Lines: 0 lines available
• Carrying any Kctd19 Mutation: 52 strains or lines available

References

• Original: J:306305 Oura S, et al., KCTD19 and its associated protein ZFP541 are independently essential for meiosis in male mice. PLoS Genet. 2021 May;17(5):e1009412
• All: 2 reference(s)