Zfp541^em1Osb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp541^em1Osb
• Name: zinc finger protein 541; endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University
• MGI ID: MGI:6758830
• Synonyms: Zfp541^em1Maik, Zfp541 KO
• Gene: Zfp541 Location: Chr7:15795739-15830259 bp, + strand Genetic Position: Chr7, 8.74 cM
• Alliance: Zfp541^em1Osb page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:306305
• Parent Cell Line: EGR-G01 (ES Cell)
• Strain of Origin: (129S2/SvPas x C57BL/6NSlc)F1-Tg(CAG-EGFP,Acr-EGFP)2Osb

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Sequence upstream of exon 1 and in intron 8 were targeted with a pair of sgRNAs (targeting (1) TCCACTTCTCTAGTGCTAGG and (3) AGGCAGCTACACCACCCTCC), resulting in the deletion between sgRNA targets 1 and 3 containing exons 1-8. The ESCs used for the creation of this allele also contain the Tg(CAG-EGFP,Acr-EGFP)2Osb double transgene. (J:306305)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp541 Mutation: 48 strains or lines available

References

• Original: J:306305 Oura S, et al., KCTD19 and its associated protein ZFP541 are independently essential for meiosis in male mice. PLoS Genet. 2021 May;17(5):e1009412
• All: 1 reference(s)