Rps21^em2Utr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rps21^em2Utr
• Name: ribosomal protein S21; endonuclease-mediated mutation 2, University of Tsukuba Laboratory Animal Resource Center
• MGI ID: MGI:6761757
• Synonyms: Rps21^indel
• Gene: Rps21 Location: Chr2:179899172-179900237 bp, + strand Genetic Position: Chr2, 102.78 cM
• Alliance: Rps21^em2Utr page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: CRISPR-targeting using an sgRNA targeting CCGAGGTGAGCTGGGAACCTGAC in exon 3 produced an indel that results in a frameshift and premature termination. (J:309963)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rps21 Mutation: 12 strains or lines available

References

• Original: J:309963 Dinh TTH, et al., Disruption of entire Cables2 locus leads to embryonic lethality by diminished Rps21 gene expression and enhanced p53 pathway. Elife. 2021 May 5;10:e50346
• All: 1 reference(s)