Nbn^em6Jpt
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nbn^em6Jpt
• Name: nibrin; endonuclease-mediated mutation 6, John H Petrini
• MGI ID: MGI:6771584
• Synonyms: Nbs1^mid7c
• Gene: Nbn Location: Chr4:15957925-15992589 bp, + strand Genetic Position: Chr4, 6.66 cM, cytoband A
• Alliance: Nbn^em6Jpt page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutations: Insertion, Intragenic deletion
• Mutation details: TALEN-mediated genome-editing generated an insertion of TTTTTTATAATATAAAATAAG replacing CTGAAGAATTT in the Mre11 interacting domain of exon 13 (a total of 10 bp insertion) resulting in a stop codon and truncated protein. (J:251434)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nbn Mutation: 59 strains or lines available

References

• Original: J:251434 Kim JH, et al., The Mre11-Nbs1 Interface Is Essential for Viability and Tumor Suppression. Cell Rep. 2017 Jan 10;18(2):496-507
• All: 1 reference(s)