Dnah10^em1Yxc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dnah10^em1Yxc
• Name: dynein, axonemal, heavy chain 10; endonuclease-mediated mutation 1, Yunxia Cao
• MGI ID: MGI:6780038
• Gene: Dnah10 Location: Chr5:124802149-124911372 bp, + strand Genetic Position: Chr5, 63.78 cM
• Alliance: Dnah10^em1Yxc page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 mediated recombination using 2 guide RNAs (sgRNA-1: ATCTTATGCTGGGTCCAGTAAGG, sgRNA-2: TTTATAACAAATGGCTTGATTGG) deleted a genomic region spanning exons 2 - 5. Immunostaining confirmed the absence of protein expression in testes and spermatozoa from homozygous mice. (J:311550)

Disease models

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dnah10 Mutation: 175 strains or lines available

References

• Original: J:311550 Tu C, et al., Bi-allelic mutations of DNAH10 cause primary male infertility with asthenoteratozoospermia in humans and mice. Am J Hum Genet. 2021 Aug 5;108(8):1466-1477
• All: 1 reference(s)