Elovl2^em1Haml
Endonuclease-mediated Allele Detail

Summary

• Symbol: Elovl2^em1Haml
• Name: ELOVL fatty acid elongase 2; endonuclease-mediated mutation 1, Bruce Hamilton
• MGI ID: MGI:6782853
• Synonyms: Elovl2^C234W
• Gene: Elovl2 Location: Chr13:41335858-41373879 bp, - strand Genetic Position: Chr13, 20.38 cM
• Alliance: Elovl2^em1Haml page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: Cysteine codon 234 (TGT) was targeted for change to a tryptophan codon (TGG)(p.C234W) with an sgRNA (targeting GTCTTCCTATATGATGACGC) and an ssODN template (TTTCCCTTCGGCTGGCTCATCTTCCAGTCTTCCTATATGATGACGTTAGTC). The mutation selectively abolishes the enzymatic activity needed to process C22 polyunsaturated fatty acids, while leaving other enzymatic activity intact. (J:284063)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Elovl2 Mutation: 13 strains or lines available

References

• Original: J:284063 Chen D, et al., The lipid elongation enzyme ELOVL2 is a molecular regulator of aging in the retina. Aging Cell. 2020 Feb;19(2):e13100
• All: 1 reference(s)