Washc4^em1Ssod
Endonuclease-mediated Allele Detail

Summary

• Symbol: Washc4^em1Ssod
• Name: WASH complex subunit 4; endonuclease-mediated mutation 1, Scott H Soderling
• MGI ID: MGI:6783463
• Synonyms: SWIP^P1019R
• Gene: Washc4 Location: Chr10:83379616-83432337 bp, + strand Genetic Position: Chr10, 41.29 cM
• Alliance: Washc4^em1Ssod page

Mutation origin

• Strain of Origin: (C57BL/6J x SJL/J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: Proline codon 1019 (CCT) in exon 29 was targeted for change to an arginine codon (CGT)(p.P1019R) with an sgRNA (targeting TTGAGAATACTCACAAGAGGAGG) and an ssODN template (ATTTCGAAGGCCAAAGAATATACATCTCCGAAATTTCTATATCATTGTTCGTCCTCTTGTGAGTATTCTCAAAACTAGAAGTGAGTTATTGATGGGTGTTAATACAGATTCAGTTTCCATAAAGCA) using CRISPR/Cas9 technology. The mutation mimics a mutation found in some human WiskottAldrich syndrome patients. (J:303795)

Disease models

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Washc4 Mutation: 62 strains or lines available

References

• Original: J:303795 Courtland JL, et al., Genetic disruption of WASHC4 drives endo-lysosomal dysfunction and cognitive-movement impairments in mice and humans. Elife. 2021 Mar 22;10:e61590
• All: 1 reference(s)