Ercc6l2^em2Mengf
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ercc6l2^em2Mengf
• Name: excision repair cross-complementing rodent repair deficiency, complementation group 6 like 2; endonuclease-mediated mutation 2, Feilong Meng
• MGI ID: MGI:6792078
• Synonyms: Ercc6l2^D270N
• Gene: Ercc6l2 Location: Chr13:63963054-64048116 bp, + strand Genetic Position: Chr13, 33.1 cM, cytoband B3
• Alliance: Ercc6l2^em2Mengf page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Aspartic acid codon 270 (GAT) in exon 5 was targeted for change to asparagine (AAT)(p.D270N) with an sgRNA (targeting CTTCATAACTTCTGTAACTC) and an ssODN template using CRISPR/Cas9 technology. This mutation in the DEAH-box helicase catalytic site of the encoded peptide mimics one that is found in some inherited bone marrow failure (BMF) patients and renders the enzyme catalytic-dead. (J:311900)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ercc6l2 Mutation: 38 strains or lines available

References

• Original: J:311900 Liu X, et al., ERCC6L2 promotes DNA orientation-specific recombination in mammalian cells. Cell Res. 2020 Sep;30(9):732-744
• All: 1 reference(s)