Nhej1^em1Mengf
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nhej1^em1Mengf
• Name: non-homologous end joining factor 1; endonuclease-mediated mutation 1, Feilong Meng
• MGI ID: MGI:6792079
• Synonyms: Xlf^-
• Gene: Nhej1 Location: Chr1:75006505-75101870 bp, - strand Genetic Position: Chr1, 38.56 cM, cytoband C3
• Alliance: Nhej1^em1Mengf page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: The 5' UTR and intron 2 were targeted by two sgRNA (targeting TTGTGGTCCAGATATGGAATT and CCTTAGCAGAGATGTTAAGTT) using CRISPR/Cas9 technology, resulting in the deletion of exon 2 and most of exon 1. (J:311900)

Phenotypes

Key:

hm	homozygous	ht	heterozygous	tg	involves transgenes	√	phenotype observed
cn	conditional genotype	cx	complex: > 1 genome feature	ot	other: hemizygous, indeterminate,...	N	normal phenotype

Genotype/
Background:

	Allelic Composition	Genetic Background	Cell Line(s)
Loading...
cx1	Ercc6l2^em1Mengf/Ercc6l2^em1Mengf Nhej1^em1Mengf/Nhej1^em1Mengf	Not Specified

Phenotypes:

Affected Systems	cx1
show or hide all annotated terms
hematopoietic system	√
abnormal T cell receptor V(D)J recombination	√
immune system	√
abnormal T cell receptor V(D)J recombination	√

View phenotypes and curated references for all genotypes (concatenated display).

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nhej1 Mutation: 16 strains or lines available

References

• Original: J:311900 Liu X, et al., ERCC6L2 promotes DNA orientation-specific recombination in mammalian cells. Cell Res. 2020 Sep;30(9):732-744
• All: 1 reference(s)