Atp5if1^em1Jpy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atp5if1^em1Jpy
• Name: ATP synthase inhibitory factor subunit 1; endonuclease-mediated mutation 1, Jianping Ye
• MGI ID: MGI:6792081
• Synonyms: ATPIF^-, IF^-
• Gene: Atp5if1 Location: Chr4:132257866-132260970 bp, - strand Genetic Position: Chr4, 65.51 cM
• Alliance: Atp5if1^em1Jpy page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: CRISPR/cas9 mediated recombination using two sgRNAs (targeting GCAGTCGGATAGCATGGATACGG and GGCTCCACCAGCTTCTCGGATGG) created a 3 bp insertion (GGT) and 9 bp deletion (TCCATCCGA) in exon 2. Western blot analysis confirmed the absence of expression in spleens from homozygous mice. (J:312819, J:313048)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Atp5if1 Mutation: 22 strains or lines available

References

• Original: J:313048 Wang Y, et al., Mitochondrial protein IF1 is a potential regulator of glucagon-like peptide (GLP-1) secretion function of the mouse intestine. Acta Pharm Sin B. 2021 Jun;11(6):1568-1577
• All: 3 reference(s)