About   Help   FAQ
Atp5if1em1Jpy
Endonuclease-mediated Allele Detail
Summary
Symbol: Atp5if1em1Jpy
Name: ATP synthase inhibitory factor subunit 1; endonuclease-mediated mutation 1, Jianping Ye
MGI ID: MGI:6792081
Synonyms: ATPIF-, IF-
Gene: Atp5if1  Location: Chr4:132257866-132260970 bp, - strand  Genetic Position: Chr4, 65.51 cM
Alliance: Atp5if1em1Jpy page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsCRISPR/cas9 mediated recombination using two sgRNAs (targeting GCAGTCGGATAGCATGGATACGG and GGCTCCACCAGCTTCTCGGATGG) created a 3 bp insertion (GGT) and 9 bp deletion (TCCATCCGA) in exon 2. Western blot analysis confirmed the absence of expression in spleens from homozygous mice. (J:312819, J:313048)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Atp5if1 Mutation:  22 strains or lines available
References
Original:  J:313048 Wang Y, et al., Mitochondrial protein IF1 is a potential regulator of glucagon-like peptide (GLP-1) secretion function of the mouse intestine. Acta Pharm Sin B. 2021 Jun;11(6):1568-1577
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/09/2024
MGI 6.24
The Jackson Laboratory