Maco1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Maco1^em1(IMPC)J
• Name: macoilin 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6794036
• Gene: Maco1 Location: Chr4:134530070-134580656 bp, - strand Genetic Position: Chr4, 67.11 cM
• Alliance: Maco1^em1(IMPC)J page
• IMPC: Maco1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAATATGTTGCTTGGCTTG and TTATAACCACTGCTTCCCCC, which resulted in a 505 bp deletion beginning at Chromosome 4 position 134,563,412 bp and ending after 134,563,916 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001289591 (exon 3) and 378 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 26 amino acids later. (J:188991)
• Inheritance: Not Specified

Phenotypes

Key:

hm	homozygous	ht	heterozygous	tg	involves transgenes	√	phenotype observed
cn	conditional genotype	cx	complex: > 1 genome feature	ot	other: hemizygous, indeterminate,...	N	normal phenotype

Genotype/
Background:

	Allelic Composition	Genetic Background	Cell Line(s)
Loading...
hm1	Maco1^em1(IMPC)J/Maco1^em1(IMPC)J	C57BL/6NJ-Maco1^em1(IMPC)J/Mmjax

Phenotypes:

Affected Systems	hm1
show or hide all annotated terms
Source:	IMPC - JAX
mortality/aging	√
preweaning lethality, incomplete penetrance	√

View phenotypes and curated references for all genotypes (concatenated display).

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Maco1 Mutation: 45 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)