Zfp532^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp532^em1(IMPC)J
• Name: zinc finger protein 532; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6794038
• Gene: Zfp532 Location: Chr18:65713301-65822514 bp, + strand Genetic Position: Chr18, 38.91 cM
• Alliance: Zfp532^em1(IMPC)J page
• IMPC: Zfp532 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTGGAGGGGTCTTCGTCT and CAGCACGCTGCAGACACCAG, which resulted in a 107 bp deletion beginning at Chromosome 18 position 65,758,287 bp and ending after 65,758,393 bp (GRCm39/mm39). This mutation deletes 107 bp of ENSMUSE00001378438 (exon 3) and is predicted to cause a change of amino acid sequence after residue 740 and early truncation 13 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp532 Mutation: 484 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)