Lmod1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lmod1^em1(IMPC)J
• Name: leiomodin 1 (smooth muscle); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6794057
• Gene: Lmod1 Location: Chr1:135252551-135295803 bp, + strand Genetic Position: Chr1, 58.51 cM, cytoband F
• Alliance: Lmod1^em1(IMPC)J page
• IMPC: Lmod1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTTCGGTTGAGTTCTGTAG and TCCCAGAGCCAATTAGGCCT, which resulted in a 4824 bp deletion beginning at Chromosome 1 position 135,291,253 bp and ending after 135,296,076 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000396118 and ENSMUSE00000361252 (exons 2 and 3) and 1340 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 51 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Lmod1 Mutation: 27 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)