Laptm4b^em1Huty
Endonuclease-mediated Allele Detail

Summary

• Symbol: Laptm4b^em1Huty
• Name: lysosomal-associated protein transmembrane 4B; endonuclease-mediated mutation 1, Huang-Tian Yang
• MGI ID: MGI:6802143
• Synonyms: LAPTM4B^-
• Gene: Laptm4b Location: Chr15:34238279-34284448 bp, + strand Genetic Position: Chr15, 13.98 cM
• Alliance: Laptm4b^em1Huty page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 1 was targeted with an sgRNA (targeting CGCACCGGCACCATCCTGCTGG) using CRISPR/Cas9 technology, resulting in a 10 bp deletion (GCACCATCCT) that leads to a reading frame shift and premature stop codon (p.T25Wfs*6). (J:310542)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Laptm4b Mutation: 18 strains or lines available

References

• Original: J:310542 Gu S, et al., Downregulation of LAPTM4B Contributes to the Impairment of the Autophagic Flux via Unopposed Activation of mTORC1 Signaling During Myocardial Ischemia/Reperfusion Injury. Circ Res. 2020 Sep 11;127(7):e148-e165
• All: 1 reference(s)