About   Help   FAQ
Laptm4bem1Huty
Endonuclease-mediated Allele Detail
Summary
Symbol: Laptm4bem1Huty
Name: lysosomal-associated protein transmembrane 4B; endonuclease-mediated mutation 1, Huang-Tian Yang
MGI ID: MGI:6802143
Synonyms: LAPTM4B-
Gene: Laptm4b  Location: Chr15:34238279-34284448 bp, + strand  Genetic Position: Chr15, 13.98 cM
Alliance: Laptm4bem1Huty page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExon 1 was targeted with an sgRNA (targeting CGCACCGGCACCATCCTGCTGG) using CRISPR/Cas9 technology, resulting in a 10 bp deletion (GCACCATCCT) that leads to a reading frame shift and premature stop codon (p.T25Wfs*6). (J:310542)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Laptm4b Mutation:  18 strains or lines available
References
Original:  J:310542 Gu S, et al., Downregulation of LAPTM4B Contributes to the Impairment of the Autophagic Flux via Unopposed Activation of mTORC1 Signaling During Myocardial Ischemia/Reperfusion Injury. Circ Res. 2020 Sep 11;127(7):e148-e165
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory