Arhgap45^em1Ciphe
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arhgap45^em1Ciphe
• Name: Rho GTPase activating protein 45; endonuclease-mediated mutation 1, Centre d'ImmunoPhenomique
• MGI ID: MGI:6806175
• Synonyms: Arhgap45^-, Arhgap45^tm1Ciphe
• Gene: Arhgap45 Location: Chr10:79852505-79867305 bp, + strand Genetic Position: Chr10, 39.72 cM
• Alliance: Arhgap45^em1Ciphe page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Introns 3 and 4 were targeted with two sgRNAs (targeting AAGAGGGGATCTCTGTCGTGGGG and CAGAGTGGAGTTCGGGAGTATGG) using CRISPR/Cas9 technology, resulting in the deletion of exon 4. Lack of peptide expression in T and B cells was experimentally confirmed. (J:282407)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Arhgap45 Mutation: 60 strains or lines available

References

• Original: J:282407 Voisinne G, et al., Quantitative interactomics in primary T cells unveils TCR signal diversification extent and dynamics. Nat Immunol. 2019 Nov;20(11):1530-1541
• All: 2 reference(s)