Slc25a2^em1Osb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc25a2^em1Osb
• Name: solute carrier family 25 (mitochondrial carrier, ornithine transporter) member 2; endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University
• MGI ID: MGI:6830922
• Gene: Slc25a2 Location: Chr18:37770431-37771776 bp, - strand Genetic Position: Chr18, 19.54 cM
• Alliance: Slc25a2^em1Osb page

Mutation origin

• Strain of Origin: (C57BL/6NJcl x DBA/2NJcl)F2

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: CRISPR/Cas9 technology generated a 795 bp deletion and a 1 bp insertion using gRNAs CAGTGAGGTCTATGGCGGCT and AGGGATGGCTCGAATCAGAG. (J:315008)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slc25a2 Mutation: 10 strains or lines available

References

• Original: J:315008 Oyama Y, et al., CRISPR/Cas9-mediated genome editing reveals 12 testis-enriched genes dispensable for male fertility in mice. Asian J Androl. 2021 Jul 16
• All: 1 reference(s)