Smim8^em1Ncvc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Smim8^em1Ncvc
• Name: small integral membrane protein 8; endonuclease-mediated mutation 1, National Cerebral and Cardiovascular Center
• MGI ID: MGI:6830924
• Synonyms: Smim8^em1Osb
• Gene: Smim8 Location: Chr4:34768664-34778398 bp, - strand Genetic Position: Chr4, 16.86 cM, cytoband A5
• Alliance: Smim8^em1Ncvc page

Mutation origin

• Strain of Origin: (C57BL/6NJcl x DBA/2NJcl)F2

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology generated a 2300 bp deletion using gRNAs TGGTTGTGTGCGCCCCTCGG and GTGAAGGGCATCGGTACATG. (J:315008)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Smim8 Mutation: 76 strains or lines available

References

• Original: J:315008 Oyama Y, et al., CRISPR/Cas9-mediated genome editing reveals 12 testis-enriched genes dispensable for male fertility in mice. Asian J Androl. 2021 Jul 16
• All: 1 reference(s)