Tomm20l^em1Kzt
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tomm20l^em1Kzt
• Name: translocase of outer mitochondrial membrane 20-like; endonuclease-mediated mutation 1, Keizo Tokuhiro
• MGI ID: MGI:6830927
• Gene: Tomm20l Location: Chr12:71158202-71169995 bp, + strand Genetic Position: Chr12, 29.39 cM, cytoband C3
• Alliance: Tomm20l^em1Kzt page

Mutation origin

• Strain of Origin: (C57BL/6NJcl x DBA/2NJcl)F2

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology generated a 483 bp deletion using gRNAs TGCAGTGTCCTTGGGTCGCC and GAGGTGCAGCAGACCCGCCA. (J:315008)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tomm20l Mutation: 17 strains or lines available

References

• Original: J:315008 Oyama Y, et al., CRISPR/Cas9-mediated genome editing reveals 12 testis-enriched genes dispensable for male fertility in mice. Asian J Androl. 2021 Jul 16
• All: 1 reference(s)