Cct8^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cct8^em1(IMPC)J
• Name: chaperonin containing TCP1 subunit 8; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6836735
• Synonyms: Cct8^-
• Gene: Cct8 Location: Chr16:87280213-87292757 bp, - strand Genetic Position: Chr16, 49.57 cM, cytoband C3.3
• Alliance: Cct8^em1(IMPC)J page
• IMPC: Cct8 gene page

Cct8^em1(IMPC)J/Cct8^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts grown in vitro fail to hatch from the zona pellucida.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGATCTTACTTGAGTAAGG and AAGTGAAAGAGACGTGTACG, which resulted in a 4192 bp deletion beginning at Chromosome 16 position 87,284,234 bp and ending after 87,288,425 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001223260, ENSMUSE00001206188, ENSMUSE00001252459, ENSMUSE00001247901, ENSMUSE00001275047 (exons 4-8) and 3482 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 11 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cct8 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)