About   Help   FAQ
Cct8em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cct8em1(IMPC)J
Name: chaperonin containing TCP1 subunit 8; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6836735
Synonyms: Cct8-
Gene: Cct8  Location: Chr16:87280213-87292757 bp, - strand  Genetic Position: Chr16, 49.57 cM, cytoband C3.3
Alliance: Cct8em1(IMPC)J page
IMPC: Cct8 gene page
Cct8em1(IMPC)J/Cct8em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts grown in vitro fail to hatch from the zona pellucida.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGATCTTACTTGAGTAAGG and AAGTGAAAGAGACGTGTACG, which resulted in a 4192 bp deletion beginning at Chromosome 16 position 87,284,234 bp and ending after 87,288,425 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001223260, ENSMUSE00001206188, ENSMUSE00001252459, ENSMUSE00001247901, ENSMUSE00001275047 (exons 4-8) and 3482 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 11 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cct8 Mutation:  30 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory