About   Help   FAQ
Banf1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Banf1em1(IMPC)J
Name: BAF nuclear assembly factor 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6836771
Synonyms: Banf1-
Gene: Banf1  Location: Chr19:5414661-5416904 bp, - strand  Genetic Position: Chr19, 4.31 cM, cytoband A
Alliance: Banf1em1(IMPC)J page
IMPC: Banf1 gene page
Banf1em1(IMPC)J/Banf1em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts in vitro fail to hatch from the zona pellucida.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAGGAATTGGGACACCCA and TGGAAATTTCCGAATAGCCG, which resulted in a 1621 bp deletion beginning at Chromosome 19 position 5,414,502 bp and ending after 5,416,122 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000145472 and ENSMUSE00000413957 (exons 2 and 3) and 961 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to create a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Banf1 Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory