Banf1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Banf1^em1(IMPC)J
• Name: BAF nuclear assembly factor 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6836771
• Synonyms: Banf1^-
• Gene: Banf1 Location: Chr19:5414661-5416904 bp, - strand Genetic Position: Chr19, 4.31 cM, cytoband A
• Alliance: Banf1^em1(IMPC)J page
• IMPC: Banf1 gene page

Banf1^em1(IMPC)J/Banf1^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts in vitro fail to hatch from the zona pellucida.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAGGAATTGGGACACCCA and TGGAAATTTCCGAATAGCCG, which resulted in a 1621 bp deletion beginning at Chromosome 19 position 5,414,502 bp and ending after 5,416,122 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000145472 and ENSMUSE00000413957 (exons 2 and 3) and 961 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to create a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Banf1 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)