About   Help   FAQ
Ankrd13bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ankrd13bem1(IMPC)J
Name: ankyrin repeat domain 13b; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6849806
Gene: Ankrd13b  Location: Chr11:77361311-77380504 bp, - strand  Genetic Position: Chr11, 46.59 cM
Alliance: Ankrd13bem1(IMPC)J page
IMPC: Ankrd13b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAAGCACTCCACCAAGCTG and GTACAGCTAGAAAAGAACTA, which resulted in a 1010 bp deletion beginning at Chromosome 11 position 77,366,728 bp and ending after 77,367,737 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000587539, ENSMUSE00001279228 and ENSMUSE00001227155 (exons 5,6,7) and 609 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 140 and early truncation 22 amino acids later. There is a 4 bp insertion AGGA at the deletion site. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ankrd13b Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory