Rnf187^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rnf187^em1(IMPC)J
• Name: ring finger protein 187; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6849819
• Gene: Rnf187 Location: Chr11:58823114-58829732 bp, - strand Genetic Position: Chr11, 36.37 cM, cytoband B2
• Alliance: Rnf187^em1(IMPC)J page
• IMPC: Rnf187 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGTCCTTGGAACCTGGTCA and ATAAGATTACTCATCCTGCA, which resulted in a 6959 bp deletion beginning at Chromosome 11 position 58,823,054 bp and ending after 58,830,012 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000590381, ENSMUSE00000105447, ENSMUSE00000105448 and ENSMUSE00000678141 (exons 1-4) and 5010 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. There is a 1 bp (T) insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rnf187 Mutation: 10 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)