Ebna1bp2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ebna1bp2^em1(IMPC)Tcp
• Name: EBNA1 binding protein 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6856862
• Synonyms: Ebna1bp2^-
• Gene: Ebna1bp2 Location: Chr4:118477996-118484973 bp, + strand Genetic Position: Chr4, 54.96 cM
• Alliance: Ebna1bp2^em1(IMPC)Tcp page
• IMPC: Ebna1bp2 gene page

Ebna1bp2^em1(IMPC)Tcp/Ebna1bp2^em1(IMPC)Tcp mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as compacted morulas. Mutants fail to hatch from the zona pellucida and are dead after 3 days in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-targeting with single guide RNAs having spacer sequences of TCAGTTATATGTGCAATCAG targeting the 5' side and ATTTGCCTAGGCGACTGGCA targeting the 3' side of a critical region. This resulted in a 399-bp deletion Chr4:118621924-118622322(GRCm38). (J:94077)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ebna1bp2 Mutation: 20 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 4 reference(s)