About   Help   FAQ
Smchd1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Smchd1em1(IMPC)Tcp
Name: SMC hinge domain containing 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6857746
Gene: Smchd1  Location: Chr17:71651484-71782338 bp, - strand  Genetic Position: Chr17, 41.87 cM
Alliance: Smchd1em1(IMPC)Tcp page
IMPC: Smchd1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1188 was generated at The Centre for Phenogenomics by injecting Cpf1 ribonucleoprotein complexes and single guide RNAs with spacer sequences of AGGTGCTTTGGAGTTCCTTCAGC targeting the 5' side and GGTCGGAGAGGTTAAGCACTGTT targeting the 3' side leading to a 1000-bp deletion from Chr17: 71455530 to 71456529 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (J:94077)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Smchd1 Mutation:  144 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory