Smchd1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Smchd1^em1(IMPC)Tcp
• Name: SMC hinge domain containing 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6857746
• Gene: Smchd1 Location: Chr17:71651484-71782338 bp, - strand Genetic Position: Chr17, 41.87 cM
• Alliance: Smchd1^em1(IMPC)Tcp page
• IMPC: Smchd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1188 was generated at The Centre for Phenogenomics by injecting Cpf1 ribonucleoprotein complexes and single guide RNAs with spacer sequences of AGGTGCTTTGGAGTTCCTTCAGC targeting the 5' side and GGTCGGAGAGGTTAAGCACTGTT targeting the 3' side leading to a 1000-bp deletion from Chr17: 71455530 to 71456529 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (J:94077)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Smchd1 Mutation: 144 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 3 reference(s)