Nelfcd^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nelfcd^em1(IMPC)J
• Name: negative elongation factor complex member C/D, Th1l; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6860664
• Gene: Nelfcd Location: Chr2:174257623-174269298 bp, + strand Genetic Position: Chr2, 97.93 cM
• Alliance: Nelfcd^em1(IMPC)J page
• IMPC: Nelfcd gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGCCTCTAAGTCTATTCAG and TCACTCCTCAGAGTGCAGAG, which resulted in a 318 bp deletion beginning at Chromosome 2 position 174,421,555 bp and ending after 174,421,872 bp (mm10). This mutation deletes ENSMUSE00001272679 (exon 4) and 208 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 105 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nelfcd Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)