Spindoc^em2Mtb
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spindoc^em2Mtb
• Name: spindlin interactor and repressor of chromatin binding; endonuclease-mediated mutation 2, Mark T Bedford
• MGI ID: MGI:6864336
• Synonyms: line 19
• Gene: Spindoc Location: Chr19:7331443-7360359 bp, - strand Genetic Position: Chr19, 5.32 cM
• Alliance: Spindoc^em2Mtb page

Mutation origin

• Strain of Origin: FVB

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Endonuclease-mediated recombination created a 27 bp (AACCTGCTGGAAGCAGGTGTTGAAGCT) deletion in this allele (line 19). (J:319478)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Spindoc Mutation: 46 strains or lines available

References

• Original: J:319478 Yang F, et al., SPINDOC binds PARP1 to facilitate PARylation. Nat Commun. 2021 Nov 4;12(1):6362
• All: 1 reference(s)