Rragc^em1Efe
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rragc^em1Efe
• Name: Ras-related GTP binding C; endonuclease-mediated mutation 1, Alejo Efeyan
• MGI ID: MGI:6874615
• Synonyms: RagC^Q119L
• Gene: Rragc Location: Chr4:123811239-123830790 bp, + strand Genetic Position: Chr4, 57.42 cM, cytoband D
• Alliance: Rragc^em1Efe page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Hypomorph)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR-cas9 mediated recombination using a guide RNA (reverse orientation TCAAAGAAGTCCATCTGCCCAGG) introduced a CAG to CTC mutation, resulting in a Q119L mutation. (J:320567)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rragc Mutation: 20 strains or lines available

References

• Original: J:320567 Ortega-Molina A, et al., Inhibition of Rag GTPase signaling in mice suppresses B cell responses and lymphomagenesis with minimal detrimental trade-offs. Cell Rep. 2021 Jul 13;36(2):109372
• All: 1 reference(s)