Tpm1^em1Clo
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tpm1^em1Clo
• Name: tropomyosin 1, alpha; endonuclease-mediated mutation 1, Cecilia Lo
• MGI ID: MGI:6879497
• Synonyms: Tpm1^K5del
• Gene: Tpm1 Location: Chr9:66929872-66956688 bp, - strand Genetic Position: Chr9, 36.27 cM
• Alliance: Tpm1^em1Clo page

Mutation origin

• Strain of Origin: (C57BL/6 x DBA/2)F1

Mutation description

• Allele Type: Endonuclease-mediated (Dominant negative, Humanized sequence, Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Using an sgRNA (CTTCTTGATGGCGTCCATGG) and an ssODN template (TCCGCTGCCTAAGGGCCCCTCGCCACCGCCACCATGGACGCCATCAAGAAGATGCAGATGCTGAAGCTCGACAAAGAGAACGCCTTGGATCGAGCTGAGCAAGCGGAGGCTGATAAGAAGGCGGC) with CRISPR/Cas9 technology, a mutation was engineered (deletion of one of lysine codons 5, 6 or 7 [p.K5del, p.K6del, p.K7del]) to mimic one linked to atrial septal defect (ASD) in human patients. (J:320916)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tpm1 Mutation: 31 strains or lines available

References

• Original: J:320916 Teekakirikul P, et al., Genetic resiliency associated with dominant lethal TPM1 mutation causing atrial septal defect with high heritability. Cell Rep Med. 2022;3
• All: 1 reference(s)