Tln2^em1Clo
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tln2^em1Clo
• Name: talin 2; endonuclease-mediated mutation 1, Cecilia Lo
• MGI ID: MGI:6879498
• Synonyms: Tln2^R2239H
• Gene: Tln2 Location: Chr9:67124369-67466985 bp, - strand Genetic Position: Chr9, 36.39 cM
• Alliance: Tln2^em1Clo page

Mutation origin

• Strain of Origin: (C57BL/6 x DBA/2)F1

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Using an sgRNA (AGGTGCGAACCAGAGCCTTG) and an ssODN template (CACCCCACCCTGCCCATACCCCTCCTTACCACCAAGACGTGTTCTAGTAGGTCCAGGTAGCCCAAGGTGCATTCTGTGCCATAATGCAAGGCTCTGGTTCGCACCTCTTCACTGACATCAGGGTA) with CRISPR/Cas9 technology, a mutation was engineered (arginine codon 2239 CGG to histidine CAT, p.R2239H) that mimics a human variant found to be protective for the atrial septal defect (ASD)-causing TPM1 p.K5del mutation in human patients. (J:320916)
• Inheritance: Dominant

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tln2 Mutation: 149 strains or lines available

References

• Original: J:320916 Teekakirikul P, et al., Genetic resiliency associated with dominant lethal TPM1 mutation causing atrial septal defect with high heritability. Cell Rep Med. 2022;3
• All: 1 reference(s)