About   Help   FAQ
Tln2em1Clo
Endonuclease-mediated Allele Detail
Summary
Symbol: Tln2em1Clo
Name: talin 2; endonuclease-mediated mutation 1, Cecilia Lo
MGI ID: MGI:6879498
Synonyms: Tln2R2239H
Gene: Tln2  Location: Chr9:67124369-67466985 bp, - strand  Genetic Position: Chr9, 36.39 cM
Alliance: Tln2em1Clo page
Mutation
origin
Strain of Origin:  (C57BL/6 x DBA/2)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing an sgRNA (AGGTGCGAACCAGAGCCTTG) and an ssODN template (CACCCCACCCTGCCCATACCCCTCCTTACCACCAAGACGTGTTCTAGTAGGTCCAGGTAGCCCAAGGTGCATTCTGTGCCATAATGCAAGGCTCTGGTTCGCACCTCTTCACTGACATCAGGGTA) with CRISPR/Cas9 technology, a mutation was engineered (arginine codon 2239 CGG to histidine CAT, p.R2239H) that mimics a human variant found to be protective for the atrial septal defect (ASD)-causing TPM1 p.K5del mutation in human patients. (J:320916)
Inheritance:    Dominant
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tln2 Mutation:  150 strains or lines available
References
Original:  J:320916 Teekakirikul P, et al., Genetic resiliency associated with dominant lethal TPM1 mutation causing atrial septal defect with high heritability. Cell Rep Med. 2022;3
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory