P2rx2^em1Xzl
Endonuclease-mediated Allele Detail

Summary

• Symbol: P2rx2^em1Xzl
• Name: purinergic receptor P2X, ligand-gated ion channel, 2; endonuclease-mediated mutation 1, Xue Zhong Liu
• MGI ID: MGI:6886215
• Synonyms: P2rx2 c.179G>C, P2rx2 KI, P2rx2 p.V61L
• Gene: P2rx2 Location: Chr5:110487678-110491078 bp, - strand Genetic Position: Chr5, 53.49 cM
• Alliance: P2rx2^em1Xzl page

Mutation origin

• Strain of Origin: CBA/J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Using sgRNA (targeting GCACGATGAAGACGTACCTG) and an ssODN template with CRISPR/Cas9 technology, valine codon 61 (GTC) in exon 2 was changed to leucine (CTC) (c.181G>C, p.V61L). This mutation mimics the human p.V60L mutation associated with a form of dominant early-onset progressive sensorineural hearing loss (DFNA41). (J:315007)
• Inheritance: Dominant

Disease models

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any P2rx2 Mutation: 31 strains or lines available

References

• Original: J:315007 Chen X, et al., Generation and characterization of a P2rx2 V60L mouse model for DFNA41. Hum Mol Genet. 2021 May 31;30(11):985-995
• All: 1 reference(s)