Nek9em1Nmz
Endonuclease-mediated Allele Detail
|
Symbol: |
Nek9em1Nmz |
Name: |
NIMA (never in mitosis gene a)-related expressed kinase 9; endonuclease-mediated mutation 1, Noboru Mizushima |
MGI ID: |
MGI:6887930 |
Synonyms: |
LIR-mutant, Nek9W967A |
Gene: |
Nek9 Location: Chr12:85346288-85386136 bp, - strand Genetic Position: Chr12, 39.63 cM
|
Alliance: |
Nek9em1Nmz page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
Mutation: |
|
Nucleotide substitutions
|
|
|
Mutation details: Using an sgRNA (targeting TCGGAGTCCTGGTGCCTCCT) and an ssODN template (TCCTGAGGGCTATGTGGGCTCAGGAGACTAGAGGCTGGGTCGACAAGAGTCTGTTCCGAGGAGGCAGGCGGACTCCGAGTCTAAGTCAGGCTTTGGATCCATTTCCATTTCTTCCTTTGCTGTCTGGGT) with CRISPR/Cas9 technology, tryptophan codon 972 (TGG) in exon 22 was changed to alanine (GCC)(p.W972A). This mutation in the LC3-interacting region (LIR) of the encoded peptide prevents binding to this domain.
(J:314513)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Nek9 Mutation: |
51 strains or lines available
|
|
Original: |
J:314513 Yamamoto Y, et al., NEK9 regulates primary cilia formation by acting as a selective autophagy adaptor for MYH9/myosin IIA. Nat Commun. 2021 Jun 2;12(1):3292 |
All: |
1 reference(s) |
|