Mageh1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Mageh1em1(IMPC)J |
Name: |
MAGE family member H1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6887985 |
Gene: |
Mageh1 Location: ChrX:151819162-151820559 bp, - strand Genetic Position: ChrX, 68.46 cM, cytoband F2
|
Alliance: |
Mageh1em1(IMPC)J page
|
IMPC: |
Mageh1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mageh1em1(IMPC)J involves 1 genes/genome features (9530051G07Rik)
View all
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGTTGTAGGGAATGGGCA and GCCAAAAGCTATGAACCAAT, which resulted in a 1786 bp deletion beginning at Chromosome X position 153,036,011 bp and ending after 153,037,796 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000377789 (exon 1) and 376 bp of flanking intergenic sequence including the start site splice acceptor and donor and is predicted to result in a null allele. In addition, this deletion removes the first exon of long noncoding (LNC)RNA 9530051G07Rik as well as 101 bp of intron 1.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|