Tmem43^em1Cby
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem43^em1Cby
• Name: transmembrane protein 43; endonuclease-mediated mutation 1, Byung Yoon Choi
• MGI ID: MGI:6888277
• Synonyms: Tmem43^KI, Tmem43-p.(Arg372Ter), Tmem43^tm1Cby
• Gene: Tmem43 Location: Chr6:91450689-91465445 bp, + strand Genetic Position: Chr6, 40.54 cM, cytoband D2
• Alliance: Tmem43^em1Cby page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Dominant negative, Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Using gRNAs (targeting TTAGAGCAGCCCACAGCGGTCGG and CCGATTAGAGCAGCCCACAGCGG) and an ssODN template with CRISPR/Cas9 technology, arginine codon 372 (CGA) in exon 12 was changed to a stop codon (TGA)(c.1114C>T, p.R372*). Proline codon 373 (CCG) was also changed to a stop codon (TGA)(c.1117_1119delinsTGA, p.P373*). The arginine residue is highly conserved and part of loop 3 between the 3rd and 4th transmembrane domains TM3 and TM4 and this mutation is associated with auditory neuropathy spectrum disorder (ANSD) in human. (J:314357)
• Inheritance: Dominant

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmem43 Mutation: 33 strains or lines available

References

• Original: J:314357 Jang MW, et al., A nonsense TMEM43 variant leads to disruption of connexin-linked function and autosomal dominant auditory neuropathy spectrum disorder. Proc Natl Acad Sci U S A. 2021 Jun 1;118(22):e2019681118
• All: 1 reference(s)