Lmbr1^em1Ndva
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lmbr1^em1Ndva
• Name: limb region 1; endonuclease-mediated mutation 1, Nadav Ahituv
• MGI ID: MGI:7256408
• Synonyms: line 517
• Gene: Lmbr1 Location: Chr5:29434800-29583414 bp, - strand Genetic Position: Chr5, Syntenic
• Alliance: Lmbr1^em1Ndva page

Mutation origin

• Strain of Origin: FVB/NJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: CRISPR/cas9-medated recombination using gRNAs (GGCTCTCCACTTCTAGCTAC AND CAACGGATCTTATGAGTTC) created a 13,432 bp deletion and a single bp insertion (T) in a region homologous to a 12 kb deletion in human acheiropodia patients. (J:306058)

Expression

In Mice Carrying this Mutation:

4 assay results

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Lmbr1 Mutation: 33 strains or lines available

References

• Original: J:306058 Ushiki A, et al., Deletion of CTCF sites in the SHH locus alters enhancer-promoter interactions and leads to acheiropodia. Nat Commun. 2021 Apr 16;12(1):2282
• All: 1 reference(s)