Otulin^em1Gvl
Endonuclease-mediated Allele Detail

Summary

• Symbol: Otulin^em1Gvl
• Name: OTU deubiquitinase with linear linkage specificity; endonuclease-mediated mutation 1, Geert van Loo
• MGI ID: MGI:7256497
• Synonyms: OTULIN^L272P
• Gene: Otulin Location: Chr15:27606005-27630793 bp, - strand Genetic Position: Chr15, 10.31 cM
• Alliance: Otulin^em1Gvl page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Using an sgRNA (targeting ATGACCCTGAACAGCTCCTG) and an ssODN template (AAGTGCCGTTCTTCTCTGTGCTCTTGTTTGCCCGAGACACATCCAATGACCCTGAACAGCCACTGAGGAACCACCTAAACCAGGTGGGACACACGGGGGGCCTTGAGCAGGTGAGTTGTGGC) with CRIRPR/Cas9 technology, leucine codon 272 (CTC) was changed to proline (CCA) (p.L272P). This mutation is associated with the OTULIN-related auto-inflammatory syndrome (ORAS or otulipenia) in humans. (J:312394)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Otulin Mutation: 24 strains or lines available

References

• Original: J:312394 Hoste E, et al., OTULIN maintains skin homeostasis by controlling keratinocyte death and stem cell identity. Nat Commun. 2021 Oct 8;12(1):5913
• All: 1 reference(s)