Abca6^em1Nju
Endonuclease-mediated Allele Detail

Summary

• Symbol: Abca6^em1Nju
• Name: ATP-binding cassette, sub-family A member 6; endonuclease-mediated mutation 1, Model Animal Research Center of Nanjing University
• MGI ID: MGI:7256952
• Synonyms: Abca6 C1366R
• Gene: Abca6 Location: Chr11:110067646-110142602 bp, - strand Genetic Position: Chr11, 73.37 cM
• Alliance: Abca6^em1Nju page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Using an sgRNA (targeting TGAGTTTGGATACTGCCCTC) and an ssODN template with CRISPR/Cas9 technology, cysteine codon 1366 (TGC) was changed to arginine (AGA) (p.C1366R). This mutation is associated with hypercholestrolemia in humans. Transcript levels from this allele are normal, but peptide expression in liver is barely detectable. (J:311129)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Abca6 Mutation: 92 strains or lines available

References

• Original: J:311129 He B, et al., Hypercholesterolemia risk associated Abca6 does not regulate lipoprotein metabolism in mice or hamster. Biochim Biophys Acta Mol Cell Biol Lipids. 2021 Nov;1866(11):159006
• All: 1 reference(s)