About   Help   FAQ
Abca6em1Nju
Endonuclease-mediated Allele Detail
Summary
Symbol: Abca6em1Nju
Name: ATP-binding cassette, sub-family A member 6; endonuclease-mediated mutation 1, Model Animal Research Center of Nanjing University
MGI ID: MGI:7256952
Synonyms: Abca6 C1366R
Gene: Abca6  Location: Chr11:110067646-110142602 bp, - strand  Genetic Position: Chr11, 73.37 cM
Alliance: Abca6em1Nju page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing an sgRNA (targeting TGAGTTTGGATACTGCCCTC) and an ssODN template with CRISPR/Cas9 technology, cysteine codon 1366 (TGC) was changed to arginine (AGA) (p.C1366R). This mutation is associated with hypercholestrolemia in humans. Transcript levels from this allele are normal, but peptide expression in liver is barely detectable. (J:311129)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Abca6 Mutation:  92 strains or lines available
References
Original:  J:311129 He B, et al., Hypercholesterolemia risk associated Abca6 does not regulate lipoprotein metabolism in mice or hamster. Biochim Biophys Acta Mol Cell Biol Lipids. 2021 Nov;1866(11):159006
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory