Alx1^em1Jian
Endonuclease-mediated Allele Detail

Summary

• Symbol: Alx1^em1Jian
• Name: ALX homeobox 1; endonuclease-mediated mutation 1, Rulang Jiang
• MGI ID: MGI:7258422
• Synonyms: Alx1^del
• Gene: Alx1 Location: Chr10:102834564-102865501 bp, - strand Genetic Position: Chr10, 53.56 cM
• Alliance: Alx1^em1Jian page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using sgRNAs targeting intron 1 (GTAAGATGTGGGTGGTACT) and intron 2 (TTACTAAGTATAGGGACAGG) deleted exon 2. Sequencing of RT-PCR products confirmed the production of mutant mRNAs from splicing exon 1 to exon 3, which leads to a frame-shift and is predicted to produce a truncated protein containing only the N-terminal region and lacking the homeodomain and the C-terminal Aristaless domain. Western blot analysis confirmed that embryos lack full-length protein and only produce truncated product that is expressed at low levels. (J:320497)

Disease models

Expression

In Structures Affected by this Mutation:

16 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Alx1 Mutation: 22 strains or lines available

References

• Original: J:320497 Iyyanar PPR, et al., Alx1 Deficient Mice Recapitulate Craniofacial Phenotype and Reveal Developmental Basis of ALX1-Related Frontonasal Dysplasia. Front Cell Dev Biol. 2022;10:777887
• All: 1 reference(s)