About   Help   FAQ
Alx1em1Jian
Endonuclease-mediated Allele Detail
Summary
Symbol: Alx1em1Jian
Name: ALX homeobox 1; endonuclease-mediated mutation 1, Rulang Jiang
MGI ID: MGI:7258422
Synonyms: Alx1del
Gene: Alx1  Location: Chr10:102834564-102865501 bp, - strand  Genetic Position: Chr10, 53.56 cM
Alliance: Alx1em1Jian page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/Cas9 technology using sgRNAs targeting intron 1 (GTAAGATGTGGGTGGTACT) and intron 2 (TTACTAAGTATAGGGACAGG) deleted exon 2. Sequencing of RT-PCR products confirmed the production of mutant mRNAs from splicing exon 1 to exon 3, which leads to a frame-shift and is predicted to produce a truncated protein containing only the N-terminal region and lacking the homeodomain and the C-terminal Aristaless domain. Western blot analysis confirmed that embryos lack full-length protein and only produce truncated product that is expressed at low levels. (J:320497)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 16 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Alx1 Mutation:  22 strains or lines available
References
Original:  J:320497 Iyyanar PPR, et al., Alx1 Deficient Mice Recapitulate Craniofacial Phenotype and Reveal Developmental Basis of ALX1-Related Frontonasal Dysplasia. Front Cell Dev Biol. 2022;10:777887
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory