Adar^em1Stsn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adar^em1Stsn
• Name: adenosine deaminase, RNA-specific; endonuclease-mediated mutation 1, Daniel B Stetson
• MGI ID: MGI:7281512
• Synonyms: Adar^P195A
• Gene: Adar Location: Chr3:89622329-89660753 bp, + strand Genetic Position: Chr3, 39.19 cM, cytoband F2
• Alliance: Adar^em1Stsn page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Using an sgRNA (targeting GAAGGGGGAAACCTCCTTTGTGG) and an ssODN template (ATCAATCGTATTTTGTACTCCCTGGAAAAGAAGGGAAAGCTGCACAGAGGAAGGGGGAAACCTGCCTTGTGGAGCCTTGTGCCCTTGAGTCAGGCTTGGACTCAGCCCCCTGGAGTTGTGAATCCAGAT) with CRISPR/Cas9 technology, proline codon 195 (CCT) was changed to alanine (GCC) (p.P195A). The mutation affects the Z-alpha Z-DNA-binding domain in the encoded peptide and is equivalent to the p.P193A mutation found in Aicardi-Goutieres syndrome (AGS) patients. (J:308678)

Disease models

Expression

In Mice Carrying this Mutation:	2 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Adar Mutation: 72 strains or lines available

References

• Original: J:308678 Maurano M, et al., Protein kinase R and the integrated stress response drive immunopathology caused by mutations in the RNA deaminase ADAR1. Immunity. 2021 Jul 29
• All: 2 reference(s)