Hsf2bp^em1Amp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hsf2bp^em1Amp
• Name: heat shock transcription factor 2 binding protein; endonuclease-mediated mutation 1, Alberto M Pendas
• MGI ID: MGI:7281837
• Synonyms: Hsf2bp^-
• Gene: Hsf2bp Location: Chr17:32163743-32253869 bp, - strand Genetic Position: Chr17, 17.25 cM
• Alliance: Hsf2bp^em1Amp page

Mutation origin

• Strain of Origin: (C57BL/6J x CBA/J)F2

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology, using an sgRNA (targeting TCACAAAACTCTCCATCGTC and ATTGGATGGGGATGTCAAGG), generated a 28 bp deletion (GACATCCCCATCCAATGACTTCACAAAA, GRCm39:chr17:32230208-32230235) in exon 5, leading to a frameshift and premature stop codon (p.Ser167Argfs*19). Western blot analysis confirmed absence of protein. (J:303558)

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Hsf2bp Mutation: 24 strains or lines available

References

• Original: J:303558 Felipe-Medina N, et al., A missense in HSF2BP causing primary ovarian insufficiency affects meiotic recombination by its novel interactor C19ORF57/BRME1. Elife. 2020 Aug 26;9:e56996
• All: 1 reference(s)