Hsf2bp^em2Amp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hsf2bp^em2Amp
• Name: heat shock transcription factor 2 binding protein; endonuclease-mediated mutation 2, Alberto M Pendas
• MGI ID: MGI:7281840
• Synonyms: Hsf2bp^S167L
• Gene: Hsf2bp Location: Chr17:32163743-32253869 bp, - strand Genetic Position: Chr17, 17.25 cM
• Alliance: Hsf2bp^em2Amp page

Mutation origin

• Strain of Origin: (C57BL/6J x CBA/J)F2

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Hypomorph)
• Mutation: Single point mutation
• Mutation details: CRISPR/Cas9 technology, using an sgRNA (targeting TCACAAAACTCTCCATCGTC and ATTGGATGGGGATGTCAAGG) and ssODN template, generated a C-to-T change at coding nucleotide 512 (c.512C>T) resulting in a serine to leucine substitution at amino acid 171 (p.S171L) that corresponds to the human p.S167L mutation found in a clinical case with primary ovarian insufficiency. Immunofluorescence shows reduced protein expression in testes lysates. (J:303558)

Disease models

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Hsf2bp Mutation: 24 strains or lines available

References

• Original: J:303558 Felipe-Medina N, et al., A missense in HSF2BP causing primary ovarian insufficiency affects meiotic recombination by its novel interactor C19ORF57/BRME1. Elife. 2020 Aug 26;9:e56996
• All: 1 reference(s)