About   Help   FAQ
Hsf2bpem2Amp
Endonuclease-mediated Allele Detail
Summary
Symbol: Hsf2bpem2Amp
Name: heat shock transcription factor 2 binding protein; endonuclease-mediated mutation 2, Alberto M Pendas
MGI ID: MGI:7281840
Synonyms: Hsf2bpS167L
Gene: Hsf2bp  Location: Chr17:32163743-32253869 bp, - strand  Genetic Position: Chr17, 17.25 cM
Alliance: Hsf2bpem2Amp page
Mutation
origin
Strain of Origin:  (C57BL/6J x CBA/J)F2
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence, Hypomorph)
Mutation:    Single point mutation
 
Mutation detailsCRISPR/Cas9 technology, using an sgRNA (targeting TCACAAAACTCTCCATCGTC and ATTGGATGGGGATGTCAAGG) and ssODN template, generated a C-to-T change at coding nucleotide 512 (c.512C>T) resulting in a serine to leucine substitution at amino acid 171 (p.S171L) that corresponds to the human p.S167L mutation found in a clinical case with primary ovarian insufficiency. Immunofluorescence shows reduced protein expression in testes lysates. (J:303558)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Hsf2bp Mutation:  24 strains or lines available
References
Original:  J:303558 Felipe-Medina N, et al., A missense in HSF2BP causing primary ovarian insufficiency affects meiotic recombination by its novel interactor C19ORF57/BRME1. Elife. 2020 Aug 26;9:e56996
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory