Brme1^em1Amp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Brme1^em1Amp
• Name: break repair meiotic recombinase recruitment factor 1; endonuclease-mediated mutation 1, Alberto M Pendas
• MGI ID: MGI:7281853
• Synonyms: Brme1^-
• Gene: Brme1 Location: Chr8:84874654-84899219 bp, + strand Genetic Position: Chr8, 40.35 cM, cytoband C3
• Alliance: Brme1^em1Amp page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:303558
• Parent Cell Line: Not Specified (ES Cell)
• Strain of Origin: (C57BL/6J x CBA/J)F2

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology, using an sgRNA (targeting AACCTCAGGGACTCTCTCTG), generated a 40 bp deletion in exon 6 (GRCm39:chr8:84893258-84893298), leading to a frameshift and premature stop codon (p.Arg142Lysfs*18). (J:303558)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Brme1 Mutation: 24 strains or lines available

References

• Original: J:303558 Felipe-Medina N, et al., A missense in HSF2BP causing primary ovarian insufficiency affects meiotic recombination by its novel interactor C19ORF57/BRME1. Elife. 2020 Aug 26;9:e56996
• All: 1 reference(s)