About   Help   FAQ
Brme1em2Amp
Endonuclease-mediated Allele Detail
Summary
Symbol: Brme1em2Amp
Name: break repair meiotic recombinase recruitment factor 1; endonuclease-mediated mutation 2, Alberto M Pendas
MGI ID: MGI:7281854
Synonyms: Brme1delta142-472
Gene: Brme1  Location: Chr8:84874654-84899219 bp, + strand  Genetic Position: Chr8, 40.35 cM, cytoband C3
Alliance: Brme1em2Amp page
Mutation
origin
Strain of Origin:  (C57BL/6J x CBA/J)F2
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/Cas9 technology, using sgRNAs (targeting AACCTCAGGGACTCTCTCTG and GAAGTCTAGTTCCATTGCTG), generated a 993 bp deletion in exon 6 (GRCm39:chr8:84893258-84894251), leading to the deletion of 331 codons and an arginine to threonine codon change at codon 142 at the deletion junction (p.Arg142_Ala473delinsThr). Western blot analysis confirmed absence of protein. (J:303558)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Brme1 Mutation:  24 strains or lines available
References
Original:  J:303558 Felipe-Medina N, et al., A missense in HSF2BP causing primary ovarian insufficiency affects meiotic recombination by its novel interactor C19ORF57/BRME1. Elife. 2020 Aug 26;9:e56996
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory