Slc2a1^em1Mase
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc2a1^em1Mase
• Name: solute carrier family 2 (facilitated glucose transporter), member 1; endonuclease-mediated mutation 1, Matthias Selbach
• MGI ID: MGI:7282075
• Synonyms: GLUT1_P485L
• Gene: Slc2a1 Location: Chr4:118966001-118994527 bp, + strand
• Alliance: Slc2a1^em1Mase page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Using an sgRNA (targeting GAGGAGCTCTTCCACCCTCT) and an ssODN template (TAGCTGCCTGTGCTCCAGAGAGATCCTTGGGCTGCAGGGAGCAGGCCGGGCTGGGTGTGGGGCTCCTCACACTTGGGAGTCCGCCCCCAacaaGTGGAAGAGCTCCTCGGGTGTCTTGTCACTTTGG) with CRISPR/Cas9 technology, proline codon 485 (CCT) in exon 10 was changed to leucine (TTG) (p.P485L). This mutation creates a dileucine motif with the downstream (C-terminal) flanking leucine in the encoded peptide, which causes mislocalization away from the plasma membrane. The mutation is associated with the human childhood onset GLUT1 deficiency syndrome 2 (GLUT1 deficiency syndrome (G1DS)). (J:308608)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Slc2a1 Mutation: 60 strains or lines available

References

• Original: J:308608 Meyer K, et al., Mutations in Disordered Regions Can Cause Disease by Creating Dileucine Motifs. Cell. 2018 Sep 20;175(1):239-253.e17
• All: 1 reference(s)