Vcp^em1Kene
Endonuclease-mediated Allele Detail

Summary

• Symbol: Vcp^em1Kene
• Name: valosin containing protein; endonuclease-mediated mutation 1, Ken Ebihara
• MGI ID: MGI:7284311
• Synonyms: Vcp^A232E
• Gene: Vcp Location: Chr4:42979964-43000507 bp, - strand Genetic Position: Chr4, 22.95 cM
• Alliance: Vcp^em1Kene page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Alanine codon 232 (GCG) was changed to glutamic acid (GAG) (p.A232E) using an sgRNA (targeting CCTGCGCTGTTTAAGGCGATTGG) and an ssODN template (AGATAAAGGAGATGGTGGAGCTGCCACTGAGACATCCTGCACTGTTTAAAGAGATTGGTGTAAAGGTGAGTATCCTAAGGTCTGTGGGGAGTCT) with CRISPR/Cas9 technology. The gain-of-function mutation is located in the D1 ATPase domain of the encoded peptide and is associated with multisystem proteinopathy in humans. (J:325062)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Vcp Mutation: 52 strains or lines available

References

• Original: J:325062 Shibuya K, et al., AAA-ATPase valosin-containing protein binds the transcription factor SREBP1 and promotes its proteolytic activation by rhomboid protease RHBDL4. J Biol Chem. 2022 Apr 14;298(6):101936
• All: 1 reference(s)