Npsr1^em1Yfu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Npsr1^em1Yfu
• Name: neuropeptide S receptor 1; endonuclease-mediated mutation 1, Ying-Hui Fu
• MGI ID: MGI:7284431
• Synonyms: Npsr1^m, Npsr1-Y206H
• Gene: Npsr1 Location: Chr9:24009292-24227694 bp, + strand Genetic Position: Chr9, 9.99 cM
• Alliance: Npsr1^em1Yfu page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Using an sgRNA (targeting ) and an ssODN template (GTCCAGCCCGTGGCCTCTCACCTGATAATTGCCAAGGGAATGAAGTACACCAGAAAGGCGACGATGGTCATGTACGGGGTCCAGTGCGAGTCATCCGGCCACAGTGCCCAGCACTGCACCTCACCATTGGAAAGTGTCCTTTTCCCAAATATGATCAGCGTGGGAATGGAGA) with CRISPR/Cas9 technology, tyrosine codon 206 (TAC) was changed to histidine (CAC) (p.Y206H). This mutation is located in a highly conserved extra-cellular domain and the equivalent mutation in humans is associated with familial natural short sleep (FNSS). (J:325012)

Disease models

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Npsr1 Mutation: 38 strains or lines available

References

• Original: J:325012 Xing L, et al., Mutant neuropeptide S receptor reduces sleep duration with preserved memory consolidation. Sci Transl Med. 2019 Oct 16;11(514):eaax2014
• All: 2 reference(s)