Pak1^em1Yuwa
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pak1^em1Yuwa
• Name: p21 (RAC1) activated kinase 1; endonuclease-mediated mutation 1, Yuichi Wakabayashi
• MGI ID: MGI:7284811
• Synonyms: Pak1-3'UTR-6^T
• Gene: Pak1 Location: Chr7:97437748-97561588 bp, + strand Genetic Position: Chr7, 53.57 cM
• Alliance: Pak1^em1Yuwa page

Mutation origin

• Strain of Origin: FVB/N

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Single point mutation
• Mutation details: Using an sgRNA (targeting ACATGAGGCTGGGATGAGCGTGG) and an ssODN template (CTTGGCACATGAGGCTGGGATGAGCATGGTTTCAGTGATTGTTCTTGGTT) with CRISPR technology, 3' UTR mutation c.*6C>T (minor allele of SNP rs31627325) was introduced to make the 3' UTR in this FVB/N strain similar to that in the MSM/Ms (Mishima Mus musculus molossinus) strain. The mutation affects the use of the proximal polyadenylation signal and reduces susceptibility to developing skin papillomas. (J:323200)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pak1 Mutation: 37 strains or lines available

References

• Original: J:323200 Okumura K, et al., Functional Polymorphism in Pak1-3' Untranslated Region Alters Skin Tumor Susceptibility by Alternative Polyadenylation. J Invest Dermatol. 2022 Mar 1
• All: 1 reference(s)